Words similar to yeast

Example sentences for: yeast

How can you use “yeast” in a sentence? Here are some example sentences to help you improve your vocabulary:

In budding yeast the active site mutation exhibits allele-specific semidominance when heterozygous with wild-type [ 51 ] , and we have made similar observations in fission yeast (W.D.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
In Drosophila there are 130 proteins with this domain while in C. elegans there are 79 and only 16 in yeast.
, which is a huge jump from a yeast cell,” says Sinclair.
Yeast cytosol (from 541,000 × g spins) containing wild-type and mutant versions of Boi1-PH were prepared and stored as described for the proteolysis assay, except that the protease inhibitors leupeptin, benzamidine, and EGTA were included.