Words similar to tgt
- tgaagccatactttaccaaccat-
- tgagtcattattggataaagaatcgtaaaaactgctttaaacgataaaa
- tgc
- tggccgtttacgtcgccgtcca-
- tggtggactctccgttcttc-
- tggttcttaacttccgccac-
- tgi
- tgn
- tgs
- tgt
- tgta
- tgtaagataaccatttgagggtgg-
- tgtacacccacacaccatcca
- tgtagttcttctcaaagggattacg-
- tgtcagttccaaacgtaaaacgg-
- th
- th-
- th--
- th--should
- th-anniversary
Example sentences for: tgt
How can you use “tgt” in a sentence? Here are some example sentences to help you improve your vocabulary:
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.
For rabbit EP2: 5'-TCC TCC CGA AAA GAA AAG TGG-3' for sense and 5'-TGT TTA CCC CGT TTT ATC AGG-3' for antisense; for rabbit GAPDH: 5'-CGG AGC CAA AAG GGT CAT CAT-3' for sense and 5'-TTT CTC CAG GCG GCA GGT CAG-3' for antisense.
To sequence the junction fragments from both strands, we performed PCR and sequencing with primers 774F and reverse primer E43+355 (5'-CAA AGT CTC TGT CTG GAA GAG AAA TGA TTT TGA-3') for FB774, and with forward primer E44 -343 (5'-CCT TAG CTT CCC AAA GTG CTA GGA TTA-3') and 890R for FB890.
QUASI performs this procedure for all replacement point mutations [ e.g. , in the example case, Tyr (tat), Ile (att), Leu (tta, ttg, and ctt), Val (gtt), Ser (tct), and Cys (tgt)].
For insertion, two complementary pre-kinased 18-mer synthetic DNA oligos having the following sequences: 5'-ATA AAC AAT GAG ACA ATA-3 (sense strand) and 3'-TAT TTG TTA CTC TGT TAT-5' (antisense strand) were hybridized.
Loading...