Words similar to tgt
- tgaagccatactttaccaaccat-
- tgagtcattattggataaagaatcgtaaaaactgctttaaacgataaaa
- tgc
- tggccgtttacgtcgccgtcca-
- tggtggactctccgttcttc-
- tggttcttaacttccgccac-
- tgi
- tgn
- tgs
- tgt
- tgta
- tgtaagataaccatttgagggtgg-
- tgtacacccacacaccatcca
- tgtagttcttctcaaagggattacg-
- tgtcagttccaaacgtaaaacgg-
- th
- th-
- th--
- th--should
- th-anniversary
Example sentences for: tgt
How can you use “tgt” in a sentence? Here are some example sentences to help you improve your vocabulary:
The HCMV DNA was detected using HCMV1 (5' cct agt gtg gat gac cta cgg gcc a) and HCMV2 (5' cag aca cag tgt cct ccc gct cct c) primers producing 249 bp long amplicon and the DNA of HHV6 was amplified with specific primer pair HP0 (5' ccg caa tcg aat cca cct agc gg) and HP4 (5' gtg aga acg gat tcg aac agt gct g) yielding 440 bp product [ 23 24 ] . All amplifications were carried out with 20 pmol of each primer in 2 mM solution of MgCl 2 , 2 U of Tag Special DNA polymerase (Biovendor, Czech Republic), 0.3 mM of each dNTPs, 10× reaction buffer and 1 μg of isolated DNA according to the following conditions: 96°C for 4 min, (94°C for 10 sec, 58°C for 10 sec, 72°C for 20 sec) 36 times, and final extension at 72°C for 2 min.
For insertion, two complementary pre-kinased 18-mer synthetic DNA oligos having the following sequences: 5'-ATA AAC AAT GAG ACA ATA-3 (sense strand) and 3'-TAT TTG TTA CTC TGT TAT-5' (antisense strand) were hybridized.
66: CTA G AG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG TGN NNN GTA TTA ATT TCG CGG GAT CGA (XbaI site in bold; N indicates a random sequence region)
The primers for rat TNF-α, were designed using the DNASTAR Lasergene software (Madison, WI) and the rat TNF-α cDNA sequence (GenBank accession number NM 012675), and are sense (bp 127 - 150):5'-GGG GCC ACC ACG CTC TTC TGT CTA-3' and antisense (bp 285 - 307): 5'-CCT CCG CTT GGT TTG CTA CG-3', and generate a 181 bp cDNA product.
The primer pair for β-actin was GTC CTC TCC CAA GTC CAC ACA (forward) and CTG GTC TCA AGT CAG TGT ACA GGT AA (reverse), that of IL-8 was CTG CGC CAA CAC AGA AAT TA (forward) and ATT GCA TCT GGC AAC CCT AC (reverse), that of MCP-1 was GCC TCC AGC ATG AAA GTC TC (forward) and TAA AAC AGG GTG TCT GGG GA (reverse), that of IP-10 was CCA CGT GTT GAG ATC ATT GC (forward) and TGG AAG ATG GGA AAG GTG AG (reverse), that of RANTES was CGC TGT CAT CCT CAT TGC TA (forward) and GCT GTC TCG AAC TCC TGA CC (reverse), that of MIP-1α was TGC AAC CAG TTC TCT GCA TC (forward) and ACA GGG GAA CTC TCA GAG CA (reverse), and that of MIP-1β was CTG GGT CCA GGA GTA CGT GT (forward) and ACA GTG GAC CAT CCC CAT AG (reverse).
Loading...