Words similar to tgt
- tgaagccatactttaccaaccat-
- tgagtcattattggataaagaatcgtaaaaactgctttaaacgataaaa
- tgc
- tggccgtttacgtcgccgtcca-
- tggtggactctccgttcttc-
- tggttcttaacttccgccac-
- tgi
- tgn
- tgs
- tgt
- tgta
- tgtaagataaccatttgagggtgg-
- tgtacacccacacaccatcca
- tgtagttcttctcaaagggattacg-
- tgtcagttccaaacgtaaaacgg-
- th
- th-
- th--
- th--should
- th-anniversary
Example sentences for: tgt
How can you use “tgt” in a sentence? Here are some example sentences to help you improve your vocabulary:
The primers for rat TNF-α, were designed using the DNASTAR Lasergene software (Madison, WI) and the rat TNF-α cDNA sequence (GenBank accession number NM 012675), and are sense (bp 127 - 150):5'-GGG GCC ACC ACG CTC TTC TGT CTA-3' and antisense (bp 285 - 307): 5'-CCT CCG CTT GGT TTG CTA CG-3', and generate a 181 bp cDNA product.
66: CTA G AG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG TGN NNN GTA TTA ATT TCG CGG GAT CGA (XbaI site in bold; N indicates a random sequence region)
QUASI performs this procedure for all replacement point mutations [ e.g. , in the example case, Tyr (tat), Ile (att), Leu (tta, ttg, and ctt), Val (gtt), Ser (tct), and Cys (tgt)].
For rabbit EP2: 5'-TCC TCC CGA AAA GAA AAG TGG-3' for sense and 5'-TGT TTA CCC CGT TTT ATC AGG-3' for antisense; for rabbit GAPDH: 5'-CGG AGC CAA AAG GGT CAT CAT-3' for sense and 5'-TTT CTC CAG GCG GCA GGT CAG-3' for antisense.
Each of the megaprimers was purified and subsequently amplified with GL1 primer (5' TGT ATC TTA TGG TAC TGT AAC TG 3'), using StuI B or HincII B plasmid as a template.
Loading...