Words similar to tgagttttc

Example sentences for: tgagttttc

How can you use “tgagttttc” in a sentence? Here are some example sentences to help you improve your vocabulary:

The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).