Example sentences for: tgacatctgagctctatgagggt

How can you use “tgacatctgagctctatgagggt” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast