Example sentences for: tctgtccgatgaattcatcgcc

How can you use “tctgtccgatgaattcatcgcc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The probe for exon 4 of the CG1049 gene was generated using primers CG1049EX4FWD (TCTGTCCGATGAATTCATCGCC) and CG1049EX4REV (ATGATTCAGGTTCTCACGTCCG).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast