Example sentences for: tccagcttcttggcgatcacagacttctcc

How can you use “tccagcttcttggcgatcacagacttctcc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Using conditions as above, the sense primer (nt 1932 to nt 1959) was paired with antisense primer 5'TCCAGCTTCTTGGCGATCACAGACTTCTCC3' carrying the point mutation.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast