Words similar to stromelysin-

Example sentences for: stromelysin-

How can you use “stromelysin-” in a sentence? Here are some example sentences to help you improve your vocabulary:

MMP3 also known as 53 kD polypeptide, transin or stromelysin-1, a secreted protease, may facilitate neurite growth by dissolving the extracellular matrix of the basal lamina at the growing tip of the axon (see Table 4 for references).
Primers for amplification of other gene specific transcripts were as follows; stromelysin-1; 5' GATGACAGGGAAGCTGGA forward, 5' ACTGCGAAGATCCACTGA reverse.
These include motifs for transcription factors that bind to collagenase and elastase genes and motifs for the transcription factor MEP-1, which regulates transcription from the stromelysin-1 (MMP-3) and metallothionein genes [ 18, 19].
Stromelysin-1 (SL-1) was induced almost 2-fold in C57mg cells co-cultured with Wnt-5a secreting 293T cells but not with Wnt-1 secreting 293T cells (Figure 1, panel A).
Stromelysin-3; 5' CTGCTGCTCCTGTTGCTGCT 3' forward, 5' ACCTTGGAAGAACCAAATC 3' reverse.