Words similar to stress-induced

Example sentences for: stress-induced

How can you use “stress-induced” in a sentence? Here are some example sentences to help you improve your vocabulary:

AtPLC1, a protein isolated as a dehydration and salt stress-induced gene, was able to hydrolyze phosphatidylinositol-4,5-bisphosphate and the activity was completely dependent on Ca 2+[ 42].
The SSH procedure developed by Diatchenko et al . [ 33 ] has the additional advantage that it exploits the suppression PCR effect, eliminating the need for physical separation of single- and double-stranded cDNAs [ 34 ] . We have cloned and sequenced cDNA fragments representing 1,058 stress-induced genes from eight different SSH cDNA libraries.
These studies were followed closely by the demonstration of gene therapy in a porcine model of stress-induced myocardial ischemia.
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
Likewise, the sE supplementation used caused low expression of the stress-induced isoform of heme oxygenase, (HO-1).