Words similar to stress-induced
Example sentences for: stress-induced
How can you use “stress-induced” in a sentence? Here are some example sentences to help you improve your vocabulary:
These studies were followed closely by the demonstration of gene therapy in a porcine model of stress-induced myocardial ischemia.
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
For instance, the authors concluded that the stress-induced chaperonins ('heat-shock' genes) were upregulated by 30 minutes of exposure to 7% v/v ethanol [ 11].
Aside from its well-characterized role in protein folding [ 66 ] , Hsp70 is known to associate with the GR in the cytoplasm, where it promotes formation of a heterocomplex between the inactive GR and Hsp90 [ 67 ] . In addition, Hsp70 becomes concentrated in the nucleus when cells are exposed to environmental stress [ 68 ] . Of particular note, the nuclear accumulation of the Hsp70, Ssa4p, in response to nutrient deprivation in yeast appears to occur by a novel mechanism that involves its direct interaction with Mmd5p, a member of the importin-β family [ 69 ] . A role for Rab24 in nuclear trafficking would be unanticipated, since the only GTPase known to function in nuclear import/export (Ran) is structurally distinct from the Rab subgroup of the Ras superfamily [ 70 71 ] . Nevertheless, we can speculate that if Rab24 participates in a stress-induced pathway for nuclear import of Hsp70 in mammalian cells, the constitutive overexpression of Rab24(D123I) might stimulate aberrant accumulation of Hsp70/importin-β aggregates at the nuclear pore complex.
AtPLC1, a protein isolated as a dehydration and salt stress-induced gene, was able to hydrolyze phosphatidylinositol-4,5-bisphosphate and the activity was completely dependent on Ca 2+[ 42].
Loading...