Words similar to stress-induced

Example sentences for: stress-induced

How can you use “stress-induced” in a sentence? Here are some example sentences to help you improve your vocabulary:

Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
For instance, the authors concluded that the stress-induced chaperonins ('heat-shock' genes) were upregulated by 30 minutes of exposure to 7% v/v ethanol [ 11].
Likewise, the sE supplementation used caused low expression of the stress-induced isoform of heme oxygenase, (HO-1).
Recently, the oxidative, stress-induced thioredoxin-2 from
Substantial evidence exists to suggest that stress-induced apoptosis is mediated through activation of MAPK signaling pathways in non-ovarian cell types.