Words similar to smai

Example sentences for: smai

How can you use “smai” in a sentence? Here are some example sentences to help you improve your vocabulary:

The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.
pEGFP-N346 was generated by inserting a HindIII-NdeI fragment (containing amino acid 70-416 of MmCOP1; NdeI site was filled in by Klenow DNA polymerase) into pEGFP vector digested by HindIII and SmaI.
sα i2 was excised from pSVsGi2 using EcoRI and SmaI and subcloned into the EcoRI and EcoRV sites of pcDNAI to produce sα i2 -pcDNAI.
The resulting fragment (hCARΔcyt) was restriction endonuclease digested and subcloned into the EcoRI/SmaI site of the VA human CD2 mini-gene containing the human CD2 promoter and 3' LCR [ 16 ] . Automated sequencing (Applied Biosystems, Foster City, CA; University of Alabama at Birmingham Department of Microbiology sequencing facility) of the entire construct confirmed its accuracy.
This assay employed transfection of a plasmid containing the 230 bp SmaI fragment of ori s , the HSV origin of replication, and a LacZ reporter gene, into Vero cells.