Example sentences for: smai

How can you use “smai” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The resulting fragment (hCARΔcyt) was restriction endonuclease digested and subcloned into the EcoRI/SmaI site of the VA human CD2 mini-gene containing the human CD2 promoter and 3' LCR [ 16 ] . Automated sequencing (Applied Biosystems, Foster City, CA; University of Alabama at Birmingham Department of Microbiology sequencing facility) of the entire construct confirmed its accuracy.

  • sα i2 was excised from pSVsGi2 using EcoRI and SmaI and subcloned into the EcoRI and EcoRV sites of pcDNAI to produce sα i2 -pcDNAI.

  • This assay employed transfection of a plasmid containing the 230 bp SmaI fragment of ori s , the HSV origin of replication, and a LacZ reporter gene, into Vero cells.

  • pEGFP-N280 and pFLAG-N280 were generated by inserting a HindIII-StyI fragment (containing amino acid 70-350 of MmCOP1; StyI site was filled in by Klenow DNA polymerase) into pEGFP and pFLAG-CMV vectors digested by HindIII and SmaI.

  • The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast