Words similar to smai
Example sentences for: smai
How can you use “smai” in a sentence? Here are some example sentences to help you improve your vocabulary:
This assay employed transfection of a plasmid containing the 230 bp SmaI fragment of ori s , the HSV origin of replication, and a LacZ reporter gene, into Vero cells.
After polishing the ends of the fragments using Klenow (New England Biolabs, Beverly, MA), they were cloned into SmaI -restricted/CIAP pUC18 vector.
The resulting fragment (hCARΔcyt) was restriction endonuclease digested and subcloned into the EcoRI/SmaI site of the VA human CD2 mini-gene containing the human CD2 promoter and 3' LCR [ 16 ] . Automated sequencing (Applied Biosystems, Foster City, CA; University of Alabama at Birmingham Department of Microbiology sequencing facility) of the entire construct confirmed its accuracy.
sα i2 was excised from pSVsGi2 using EcoRI and SmaI and subcloned into the EcoRI and EcoRV sites of pcDNAI to produce sα i2 -pcDNAI.
The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.
Loading...