Words similar to smai

Example sentences for: smai

How can you use “smai” in a sentence? Here are some example sentences to help you improve your vocabulary:

The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.
After polishing the ends of the fragments using Klenow (New England Biolabs, Beverly, MA), they were cloned into SmaI -restricted/CIAP pUC18 vector.
pEGFP-N280 and pFLAG-N280 were generated by inserting a HindIII-StyI fragment (containing amino acid 70-350 of MmCOP1; StyI site was filled in by Klenow DNA polymerase) into pEGFP and pFLAG-CMV vectors digested by HindIII and SmaI.
sα i2 was excised from pSVsGi2 using EcoRI and SmaI and subcloned into the EcoRI and EcoRV sites of pcDNAI to produce sα i2 -pcDNAI.
This assay employed transfection of a plasmid containing the 230 bp SmaI fragment of ori s , the HSV origin of replication, and a LacZ reporter gene, into Vero cells.