Words similar to sets

Example sentences for: sets

How can you use “sets” in a sentence? Here are some example sentences to help you improve your vocabulary:

Whether due to chance fixation, selection or epistasis, non-syntenic associations of the sort illustrated in Figure 7are a major source of both false-positive and false-negativeresults in using RI sets for mapping.
Specific techniques for handling multisite data sets Matrix of categories, graphic data displays, tabulating frequency of different events, developing complex tabulations to check for relationships, and ordering information chronologically for time series analysis
The sequencing of entire genomes, in addition to new computer-based search tools has allowed us to identify and analyze large sets of data very rapidly.
Primers sets for the epithelial calcium channel were as follows: sense primer 5'TGAACCTGGTGCGCGCACTGC3' (GenBank accession number AJ271207.
Our data indicate that different Wnts can stimulate distinct sets of genes.