Words similar to sense-strand
Example sentences for: sense-strand
How can you use “sense-strand” in a sentence? Here are some example sentences to help you improve your vocabulary:
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
For each gene, a set of four primers was synthesized: LI, a 20-mer corresponding to the sense-strand sequence of the 5'-flanking region ~1.
A positive hybridization signal (threefold above background) was obtained for 65 of the 75 sense-strand oligonucleotide probes interrogated with labeled target.