Words similar to rsa

Example sentences for: rsa

How can you use “rsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
fingerprint MCP-2, Bfa I, Hinf I, Rsa I, Dpn I, Dde I, Alu I) CTAGN 177-181 GANTCN 90-94 GTACN 3-7 GATCN 41-45 CTNAGN 123-127 AGCT were derived from the restriction fingerprints.
5 U Bfa I, 1.0 U Dde I, 1.5 U Dpn I, 2.0 U Alu I, 1.0 U Rsa I, or 2.0 U Hinf I) were diluted in 10 μl buffer (20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT, 100 μg/ml BSA) and added separately to the six rections (FAM: Bfa I and Dde I, JOE: Dpn I and Alu I, NED: Rsa I and Hinf I).
SLC, MJH, RSA and SAC mapped in vitro Cdc5 phosphorylation sites on Net1N and in vivo phosphorylation sites on Net1.
The SSCA patterns of Rsa I digested RT-PCR products were indistinguishable from controls, indicating that transcript levels were equal for both alleles (Fig.