Words similar to rsa

Example sentences for: rsa

How can you use “rsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

Increasing the parameter k might help separating the effects of real synchronization from those of low bivariate signal variability or long-term frequency coordination, but it is not realistic to count only RSA patterns which are stable over at least k = 3 heartbeats.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
The basic idea is to make use of the recurrence of RSA pattern classes in order to detect intermittent cardiorespiratory coordination.
Since Alu I and Rsa I cut at different sites, the resulting digests contain different distributions of DNA species.
Then, RSA pattern recurrence could be formally defined by the following condition: