Words similar to rigat
Example sentences for: rigat
How can you use “rigat” in a sentence? Here are some example sentences to help you improve your vocabulary:
The insertion/deletion genotype of subjects was performed using purified genomic DNA (prepared as above) and the polymerase chain reaction using the forward primer 5'CTGGAGACCACTCCCATCCTTTCT3' and the reverse primer 5'GATGTGGCCATCACATTCGTCAGAT3' as per Rigat et al [ 13].
Loading...