Words similar to rev

Example sentences for: rev

How can you use “rev” in a sentence? Here are some example sentences to help you improve your vocabulary:

The probe for exon 4 of the CG8677 gene was generated using primers CG8677FWD (ATCCGTACCAGTGGCTAAAAGG) and CG8677REV (TTCTTCAACAGCACCACTCGTC).
The pessimistic spin, from Lyons' possible successor, the Rev.
The Rev.
Newsweek 's cover story praises the Rev.
Many writers have collected gems of Sussex dialect down the years, like Rev. William Parish and another cleric, Rev. Edward Boys Ellman, both before World War I.