Words similar to region

Example sentences for: region

How can you use “region” in a sentence? Here are some example sentences to help you improve your vocabulary:

The EGF-like region (amino acid residues Asp 106-His 159) of monkey proHB-EGF [ 2 ] was amplified by PCR using primers MkHB-EGF 5'CTAGGGAAGGAATTCGACCCATGTCTTCGG and MkHB-EGF 3'CACAGCCAGGATGGATCCTCAATGGTCATAGG.
Figure 4shows the region of mec-3gfp included in each of the plasmids, the combined distribution of ALM positions from three strains transformed with each construct, the percent of ALMs that showed migration defects (those located anterior to position 8) and the total number of ALMs scored.
On the eastern flank of the Apennines, the Abruzzi region, of which the province of Molise is a recently created offshoot, came under Roman domination in the third century b.c.
Marker transfer experiments involved co-transfection of HSV-2 pol coding region (HSV-2 SB5, HSV-2 83D, HSV-2 6652 and HSV-2 6757 described in [ 21 ] ) with HP66 viral DNA into Vero cells.
Alternating 600 to 200 million years ago between dry land and sea, the region developed a plant and animal life that decayed to form the oil, coal, and natural gas at the base of the province’s modern prosperity.