Words similar to reading
- re
- rea
- reach
- reaching
- read
- reader
- readers
- readership
- readfield
- readily-arrived-at
- readily-measured
- readiness
- readiness-enhancing
- readiness-to-change
- reading
- reading--now
- reading--or
- reading--that
- reading--unmistakably--
- reading-frame-dependent
- readings
- readjusting
- readme
- readme--that
- readouts
- reagent
- reagents
- real
- real-sub
Example sentences for: reading
How can you use “reading” in a sentence? Here are some example sentences to help you improve your vocabulary:
After a deep reading of the text I can tell you that George is one of the more aggressively hetero hippos in American literature.
Clinton refused to answer specific questions about sex acts, instead reading a prepared speech, the text of which the Times prints.
I bet any number of people reading this exchange could do as well or better.
The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.
Here's my thinking on the subject: Magazine buyers are people who've chosen reading over watching television or going to the mall or playing video games as a form of entertainment.
Loading...