Words similar to random-primed

Example sentences for: random-primed

How can you use “random-primed” in a sentence? Here are some example sentences to help you improve your vocabulary:

This result was identical to that obtained when both gene-specific and random-primed reverse transcription, followed by RACE with the same multiple gene-specific primers as above, were performed on a non-Clontech sample of total RNA freshly extracted from a kidney biopsy.
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.