Example sentences for: q

How can you use “q” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • We identified two known duplications from this analysis, which is in agreement with previous segmental duplication analyses available from the UCSC Genome Browser [ 14 16 ] . The first is derived from the a duplication of the CHRNA7 gene, characterized in detail by Riley et al . [ 17 ] . This sequence was duplicated from the intact CHRNA7 locus in 15q13.

  • 3, 1q25 and 9q34 as clusters.

  • Modulation of this mitogenic pathway occurs in part via the M6P/IGF2R, which functions in the internalization and degradation of IGF-II [ 10 ] . M6P/IGF2R is also important in activation of TGF-β, a potent growth inhibitor for most cell types, and in binding, transport and activation of lysosomal enzymes, such as cathepsins [ 12 13 ] . It has been shown that M6P/IGF2R expression is significantly reduced in both rat and human hepatocellular carcinomas [ 14 ] . Loss of hetorozygosity (LOH) at the M6P/IGF2 receptor gene locus on 6q26-27 coupled with somatic point mutations in the remaining allele has recently been demonstrated in liver and breast cancers [ 15 16 17 18 19 20 21 22 23 ] . In addition, somatic mutations of the M6P/IGF2R gene were also found in prostate cancer, lung carcinoma, and genetically unstable cancers of the endometrium, brain, stomach and colorectum [ 24 25 26 27 28 29 ] . The findings of LOH and mutations of M6P/IGF2R in a wide variety of tumor types have led to the proposition that the M6P/IGF2R is a tumor suppressor gene.

  • The extracellular domain (amino acid residues Glu 24-His 159) of monkey proHB-EGF (GenBank accession number Q09118) [ 2 ] was amplified by PCR using primers MkHB-EGF ex (5') TCGGCACTGGTGGAATTCGAGAGCCTGGAG and MKHB-EGF ex (3') CACAGCCAGGATGGATCCATGGTCATAGGT.

  • For example, the kinetics of inactivation of a bacteriophage by potassium ferrate was studied with the F-specific RNA-coliphage Q beta.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast