Words similar to pry

Example sentences for: pry

How can you use “pry” in a sentence? Here are some example sentences to help you improve your vocabulary:

It is too cynical to foresee that some irreverent smarty-pants will one day pry and dig and garner further items of unintentional humor out of our supreme poet's writings?
Annan has been trying to pry the cash out of Washington since he took office.
The scene in which Dr. Sloper pays a visit to the young suitor's sister--to pry from her a confirmation of his suspicions about her brother's character--no longer climaxes with the woman's expulsive warning to keep Catherine from marrying him.
PCR amplification was performed using primers Pry1 (CCTTAGCATGTCCGTGGGGTTTGAAT) and IR (CGGGACCACCTTATGTTATTTCATCATG) located in the 3' P end.
While the critique echoes conservative complaints about multiculturalism (harassment law makes women helpless victims), it also incorporates a libertarian strain (government should not pry into consensual sexual relations) and an Epicurean one (we shouldn't penalize people with active libidos; so long as nobody gets hurt--or helped--who cares?)