Words similar to pry

Example sentences for: pry

How can you use “pry” in a sentence? Here are some example sentences to help you improve your vocabulary:

These appear to be unopenable, with no locks to undo or even hinges to pry open; but press a couple of panels here, slide a couple of sections there, and you’re in.
If you favor opening foreign markets, the question forces you to oppose trade restrictions--even though the best argument for trade restrictions is that they're necessary to pry open foreign markets.
It is too cynical to foresee that some irreverent smarty-pants will one day pry and dig and garner further items of unintentional humor out of our supreme poet's writings?
PCR amplification was performed using primers Pry1 (CCTTAGCATGTCCGTGGGGTTTGAAT) and IR (CGGGACCACCTTATGTTATTTCATCATG) located in the 3' P end.
His self-effacing devotion to his art, and especially to landscape, helped to pry open the jaws of academic convention.