Words similar to pry

Example sentences for: pry

How can you use “pry” in a sentence? Here are some example sentences to help you improve your vocabulary:

It is too cynical to foresee that some irreverent smarty-pants will one day pry and dig and garner further items of unintentional humor out of our supreme poet's writings?
These appear to be unopenable, with no locks to undo or even hinges to pry open; but press a couple of panels here, slide a couple of sections there, and you’re in.
While the critique echoes conservative complaints about multiculturalism (harassment law makes women helpless victims), it also incorporates a libertarian strain (government should not pry into consensual sexual relations) and an Epicurean one (we shouldn't penalize people with active libidos; so long as nobody gets hurt--or helped--who cares?)
PCR amplification was performed using primers Pry1 (CCTTAGCATGTCCGTGGGGTTTGAAT) and IR (CGGGACCACCTTATGTTATTTCATCATG) located in the 3' P end.
“He's pry not home, but you cask his sister.”