Words similar to product
- procedures
- proceedings
- process
- processors
- procurement
- produce
- produced
- producer
- producers
- produceselectricity
- producesoutcomes
- producibility
- producible
- producing
- product
- product--an
- product--and
- product--as
- product--but
- product--is
- product-liability
- producta
- production
- productions
- productive
- products
- prof
- professional
- profile
Example sentences for: product
How can you use “product” in a sentence? Here are some example sentences to help you improve your vocabulary:
Table 3clearly shows that the sum of the tocopherol and its quinone product decreased over the 6 hr experiment suggesting that products, other than the tocopheryl quinone, were formed during the experiment.
Although it is possible that translation is initiated distal to the added stop codon, and that a shorter product results in the human than in the mouse, this would be unusual, given the length of the 5' untranslated region (UTR) that would then exist and the presence of multiple upstream initiation codons.
Sometimes a product seems to be the best of a group simply because it's the most unusual or distinctive.
With an annual budget larger than the gross domestic product of Russia, it is an empire.
1, the start codon in bold) and 5'TTATTTCCGACAAAAAGAAATATATGG 3'were first tested, but no product was obtained.
Loading...