Words similar to preciously
Example sentences for: preciously
How can you use “preciously” in a sentence? Here are some example sentences to help you improve your vocabulary:
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
The English Puritan Revolution, or Civil War, in some ways culturally the most radical of social upheavals, so annihilated religious artifacts created in England before it that they are preciously rare today; yet it affected the English language hardly at all, even temporarily.