Words similar to possibility
- portuguese
- pos
- posit
- position
- posix
- poss
- posse
- possessing
- possession
- possibilities
- possibilities--a
- possibilities--all
- possibilities--the
- possibilities--which
- possibilities—rather
- possibility
- possibility--we
- possibilitys
- possible
- possible--actually
- possible--but
- possibly
- possingham
- posslq
- post
- post-
- post-crisis
- post-modification
- postage
Example sentences for: possibility
How can you use “possibility” in a sentence? Here are some example sentences to help you improve your vocabulary:
Nested PCR was then done to eliminate the possibility of artifacts using the GeneRacer 5' nested primer and p27 Kip1primers CACGACCGCCTCTCTCGCACTCTC for human and GGACCACCGCCTCGCCTCTC for mouse (see Figs.
The couture ball dress and the standard wedding dress do, after all, keep suggesting the possibility, and Madonna's Oscar outfit this year suggests that full gowns have even attained the status of something avant-garde.
Despite the initial lack of any evidence of foul play in the crash of EgyptAir Flight 990 off the coast of Massachusetts, European newspapers clung hopefully to that possibility Monday.
But there is certainly the possibility of a pay and perks explosion among a small circle of high-profile economists.
One possibility is that the lack of SPARC causes alteration in ECM with respect to structure and/or function and thus contributes to a decrease in cell migration.
Loading...