Words similar to noti

Example sentences for: noti

How can you use “noti” in a sentence? Here are some example sentences to help you improve your vocabulary:

The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
A potential translation initiation codon in the NotI/BamHI fragment (3 kb) of clone 4B1 starts an open reading frame that encodes a polypeptide sequence highly homologous to the first six transmembrane domains of the human EP2 receptor [ 20 ] . The amino acid sequence of the open reading frame in the NotI fragment (6 kb) of clone 6A was homologous to the seventh transmembrane domain (TMD VII), followed by a short C-terminal tail and an in-frame stop codon.
The DBD and DBD + 154-257 derivatives of C/EBPα were constructed by replacing, respectively, the amino terminal 257 amino acids of C/EBPα-GFP (to the SgrAI site of C/EBPα) and the amino terminal 153 amino acids of C/EBPα-GFP (to the NotI site of C/EBPα) with oligonucleotides containing a strong Kozak sequence.
This was inserted into BigT digested with XhoI, Klenow filled, and then digested with NotI.
To make the R26R-YFP targeting construct, the EYFP cDNA was excised from pEYFP-N1 with ApaI and NotI and inserted into BigT digested with ApaI and NotI.