Words similar to noti

Example sentences for: noti

How can you use “noti” in a sentence? Here are some example sentences to help you improve your vocabulary:

The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
To make the R26R-YFP targeting construct, the EYFP cDNA was excised from pEYFP-N1 with ApaI and NotI and inserted into BigT digested with ApaI and NotI.
The resulting construct was further digested with NotI and PstI and combined with a NotI-PstI fragment containing the remaining c-terminal portion of a previously described MmCOP1 cDNA clone (GenBank accession number AF151110.
To make the R26R-CFP targeting construct pECFP was digested with AgeI, Klenow filled then digested with NotI to excise the ECFP cDNA.
7) were generated by appending C/EBPα fragments to the NotI site of DBD + 1-154, or to the SgrAI site of DBD.