Words similar to noti

Example sentences for: noti

How can you use “noti” in a sentence? Here are some example sentences to help you improve your vocabulary:

This was inserted into BigT digested with XhoI, Klenow filled, and then digested with NotI.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
The resulting plasmid was called pBigT, and its MCS contains sites for the restriction enzymes NheI, SalI, AccI, XhoI, ApaI, SacII, NotI, SacI and BclI.
The resulting construct was further digested with NotI and PstI and combined with a NotI-PstI fragment containing the remaining c-terminal portion of a previously described MmCOP1 cDNA clone (GenBank accession number AF151110.
A XbaI/NotI fragment from clone 4B1 and a NotI fragment from 6A1 hybridized to the probe and were subcloned in pBluesript II SK(-) (Stratagene) for further analysis.