Words similar to mouse

Example sentences for: mouse

How can you use “mouse” in a sentence? Here are some example sentences to help you improve your vocabulary:

The mouse and human TM and SC have similar structures, and the developmental progression is similar except for the accelerated time frame in mice.
One was the second version of the mouse genome assembly from Celera Genomics, created by using both private and public sequence information (denoted Cel2 [ 1]), and the other was the third version of the assembly from the public Mouse Genome Sequencing Consortium (denoted MGSCv3 [ 2]).
Nested PCR was then done to eliminate the possibility of artifacts using the GeneRacer 5' nested primer and p27 Kip1primers CACGACCGCCTCTCTCGCACTCTC for human and GGACCACCGCCTCGCCTCTC for mouse (see Figs.
For dual localization experiments, a 1:1000 dilution of a rabbit polyclonal anti-β-coatomer protein (β-COP) antibody (Affinity BioReagents) or a 1:200 dilution of a rabbit polyclonal anti-protein disulfide isomerase (PDI) antibody (StressGen Biotechnologies) was included with the EE mouse monoclonal.
In this current study, we investigated the response of the PTEN tumor suppressor to changes in cell-matrix interactions of anchorage-dependent human and mouse fibroblast cells.