Words similar to monkey
Example sentences for: monkey
How can you use “monkey” in a sentence? Here are some example sentences to help you improve your vocabulary:
A well-documented monkey example of social culture is the inheritance of rank positions in macaque and baboon societies.
3A) evidence that the upper band of the 55/57-kDa human and monkey myocilin doublet is the glycosylated form.
3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.
Monkey chop peppeh, indeed!
As for the square brass monkey with circular depressions for stacking cannonballs, it would have to contract a great deal more than the iron balls to cause them to tumble.
Loading...