Words similar to monkey
Example sentences for: monkey
How can you use “monkey” in a sentence? Here are some example sentences to help you improve your vocabulary:
3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.
2. NYC OFFERS $20 MILLION TAX ABATEMENT TO MONKEY Citing similar offers to Time Warner and to Ernst and Young, and noting that "This is a very wealthy monkey who will create a lot of jobs, you stupid bastards," Mayor Rudolph Giuliani announced ...
This indicates that the upper human and monkey myocilin band is glycosylated.
The animal was identified as the kind of monkey called in English a macaque , Italian macacco , here colloquially truncated.
The Yunnan golden monkey is under state protection, similar to the Giant Panda ...