Words similar to labelled

Example sentences for: labelled

How can you use “labelled” in a sentence? Here are some example sentences to help you improve your vocabulary:

This was confirmed first by using unlabeled specific competitor DNA which completely abolished the binding of 32P labelled probe.
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
The two gene fragments were labelled separately with digoxigenin-11-dUTP (Boehringer Mannheim, Germany) by nick-translation (Life Technologies Inc., Gaithersburg, MD).
Their location close to the surface suggests they become labelled in the yolk syncitial layer (YSL).
But, says neurobiologist and olfaction expert Lawrence C. Katz (Duke University, Durham, North Carolina, United States), ‘the onus is now on people who believe otherwise [than the labelled-line model] to provide compelling proof for the cross-fibre theory because now, at least at the periphery, the evidence is compelling for a labelled line for bitter, sweet, and umami’.