Words similar to labelled
Example sentences for: labelled
How can you use “labelled” in a sentence? Here are some example sentences to help you improve your vocabulary:
It dephosphorylated the small substrate p NPP, as well as histone, labelled at Ser residues.
The part of the vector containing the cDNA fragment was labelled by means of a simultaneous restriction/ligation reaction [ 21 ] with double stranded, fluorescently labeled oligonucleotides using the Bgl I site (Fig.
By 20 h pf most of the labelled structures had moved into the embryo in various and seemingly random locations.
PCR primers labelled with a fluorescent dye at the 5' end were then synthesized for those STRPs which displayed ≥ 4 alleles in the first screen.
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
Loading...