Words similar to jersey

Example sentences for: jersey

How can you use “jersey” in a sentence? Here are some example sentences to help you improve your vocabulary:

The WP and LAT front pages carry news of the decision by New Jersey to allow gay partners to jointly adopt children on the same basis as married couples, the first state to do so.
See Port Authority Police Department (PAPD) report, "Port Authority of New York and New Jersey," undated (online at www.panynj.gov).
--Peter McDonough, spokesman for New Jersey Gov.
The oligo corresponding to nucleotides -100 to -59 of RAR α promoter (antisense strand: 5' TCGACTGCCCGCCCACCGACCAATCACCAGTCAGGGGCGGATCTAC 3'; sense strand: 5' CCGGGTAGATCCGCCCCTGACTGGTGATTGGTCGGTGGGCGGGCAG 3') [ 17 ] was synthesized by the New Jersey Medical School Molecular Resource Facility.
However, his analysis ("") of the "controversy" surrounding Brandi Chastain's removal of her jersey after clinching the World Cup trophy is indulgent, quixotic, and utterly aggravating.