Example sentences for: hinf

How can you use “hinf” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 08 bp; Hinf I: 349.

  • fingerprint MCP-2, Bfa I, Hinf I, Rsa I, Dpn I, Dde I, Alu I) CTAGN 177-181 GANTCN 90-94 GTACN 3-7 GATCN 41-45 CTNAGN 123-127 AGCT were derived from the restriction fingerprints.

  • 5 U Bfa I, 1.0 U Dde I, 1.5 U Dpn I, 2.0 U Alu I, 1.0 U Rsa I, or 2.0 U Hinf I) were diluted in 10 μl buffer (20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT, 100 μg/ml BSA) and added separately to the six rections (FAM: Bfa I and Dde I, JOE: Dpn I and Alu I, NED: Rsa I and Hinf I).

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

  • After 2 hours at 37°C, the reactions were stopped by heating to 80°C for 20 minutes and the reactions Bfa I, Dpn I and Rsa I as well as Dde I, Alu I and Hinf I were pooled, respectively.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast