Example sentences for: gtgtggtagaagtcagtctccttggcca

How can you use “gtgtggtagaagtcagtctccttggcca” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The Race primers are: Primer A 5' GCATACACTCCATTCTCCAGACTGATGC 3'; primer B (nested to primer A) 5'CACTCATGATGAGCTTGTACTCGCTGTA 3'; primer F 5'GTGTGGTAGAAGTCAGTCTCCTTGGCCA 3';primer E (nested to primer F) and 5'GCTGAATGGAGAGGTTCTCCACCTTCTC 3. We generated additional 1.702 KB of cDNA for this gene for a total cDNA length of 7.194 KB.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast