Words similar to gtggataccccctcccccagcctagacc

Example sentences for: gtggataccccctcccccagcctagacc

How can you use “gtggataccccctcccccagcctagacc” in a sentence? Here are some example sentences to help you improve your vocabulary:

The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').