Words similar to gtcagtcccgggtcagtcagctactttttacgacagcaaaagat

Example sentences for: gtcagtcccgggtcagtcagctactttttacgacagcaaaagat

How can you use “gtcagtcccgggtcagtcagctactttttacgacagcaaaagat” in a sentence? Here are some example sentences to help you improve your vocabulary:

The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.