Words similar to gtagtattactagtaagtgagg

Example sentences for: gtagtattactagtaagtgagg

How can you use “gtagtattactagtaagtgagg” in a sentence? Here are some example sentences to help you improve your vocabulary:

A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).