Example sentences for: gggaattcgctatataggcttgtatacatcgaa

How can you use “gggaattcgctatataggcttgtatacatcgaa” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast