Words similar to generated

Example sentences for: generated

How can you use “generated” in a sentence? Here are some example sentences to help you improve your vocabulary:

The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).
When we first tried the new method in New York City, a number of highly significant outbreak signals were generated that were artifacts of previously unrecognized missing or incomplete data from one or more hospitals.
In the course of our work, we generated a resource of 10
As shown in Table 5, the lowest p-values generated by the permutation process were on the order of 0.0001, as expected given the number of permutations tested.
From the list of exact matches, we generated a path of ordered and oriented matches that served as landmarks for subsequent analysis.