Words similar to gcattagcggccgcgaaattaatacgactcactatagggag

Example sentences for: gcattagcggccgcgaaattaatacgactcactatagggag

How can you use “gcattagcggccgcgaaattaatacgactcactatagggag” in a sentence? Here are some example sentences to help you improve your vocabulary:

Second strand synthesis and incorporation of the T7 promoter sequence was carried out as follows: the 20 μL tailing reaction product was mixed with 0.6 μL of 25 μM T7-A 18 B primer (5'-GCATTAGCGGCCGCGAAATTAATACGACTCACTATAGGGAG(A) 18 [B], where B refers to C, G or T), 5 μL 10X EcoPol buffer (100 mM Tris-HCl pH 7.5, 50 mM MgCl 2 , 75 mM dTT), 2 μL 5.0 mM dNTPs, and 20.