Words similar to gapa-r
Example sentences for: gapa-r
How can you use “gapa-r” in a sentence? Here are some example sentences to help you improve your vocabulary:
G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.
Loading...