Example sentences for: gaggtgaacatatgggaaagataatcag

How can you use “gaggtgaacatatgggaaagataatcag” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast