Example sentences for: gagcagcggtttgcatttcttgttcgaagtcc

How can you use “gagcagcggtttgcatttcttgttcgaagtcc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The DNA fragment corresponding 214-694 of actin coding sequence was amplified by PCR using yeast genomic DNA as template and ACT1 -specific oligonucleotide primers (5' primer, 5'-gaacacggtattgtcaccaactgggacgatatgg; 3' primer, 5'-gagcagcggtttgcatttcttgttcgaagtcc).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast