Example sentences for: gaattctccacactgatgagccgcttcggcggcgaaacattcaacgcgt-

How can you use “gaattctccacactgatgagccgcttcggcggcgaaacattcaacgcgt-” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCTCCACACTGATGAGCCGCTTCGGCGGCGAAACATTCAACGCGT-3' and the corresponding reverse complementary strand were synthesized.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast