Words similar to gaacggtctagaatatattggc

Example sentences for: gaacggtctagaatatattggc

How can you use “gaacggtctagaatatattggc” in a sentence? Here are some example sentences to help you improve your vocabulary:

The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.