Words similar to gaacacggtattgtcaccaactgggacgatatgg

Example sentences for: gaacacggtattgtcaccaactgggacgatatgg

How can you use “gaacacggtattgtcaccaactgggacgatatgg” in a sentence? Here are some example sentences to help you improve your vocabulary:

The DNA fragment corresponding 214-694 of actin coding sequence was amplified by PCR using yeast genomic DNA as template and ACT1 -specific oligonucleotide primers (5' primer, 5'-gaacacggtattgtcaccaactgggacgatatgg; 3' primer, 5'-gagcagcggtttgcatttcttgttcgaagtcc).