Words similar to g

Example sentences for: g

How can you use “g” in a sentence? Here are some example sentences to help you improve your vocabulary:

Indeed, if cells depend on cyclin D-mediated G1 → S transition, passage from G 0 through the restriction point in G 1 is dependent on the de novo expression of cyclin D transcript, accumulation of nuclear cyclin D protein, and cyclin D/CDK-4/6 phosphorylation of pRb [ 20 ] . Then, although nuclear-localized cyclin D decreases in S phase in individual cells [ 21 ] , total cyclin D in asynchronously proliferating cell populations remain elevated compared to quiescent cells [ 20 ] . In renal epithelial and mesenchymal cells, cyclin D 1 is the dominant D-type cyclin activated during cell-cycle progression, both during nephrogenesis [ 22 ] and in non-viral-mediated kidney cell proliferation [ 23 ] .
There are, indeed, many words invented from pseudo-English with the suffix - man (e.g.
Already, some Republicans have disavowed him, and some historians, such as Norm Goda, Gerhard L. Weinberg, and Robert G. Kaufman, have rebutted him.
The clones were: Clone T/F 1-471 bp of 7.194 Kb cDNA [using primers T 5' GGTCTCAACTTAAACTCCAGCACCACGA 3' with the primer F] and clone G/A 246-2007 bp of 7.194 Kb cDNA [using primer G 5' GAGAAGGTGGAG AACCTCTCCATTCAGC 3' with primer A].
In contrast, our approach relies simply on the reconstitution of resistance to G418 and can be used to target transgenes to any genomic locus.