Words similar to fragment

Example sentences for: fragment

How can you use “fragment” in a sentence? Here are some example sentences to help you improve your vocabulary:

The blasticidin resistance cassette replaced a 391 bp fragment that includes the first four subdomains (the ATP binding site) of the kinase domain.
We consider the enhancer to be a functional part of both ars3002 and ars3004 . We found that the enhancer could not be substituted by a DNA fragment of the same size and base composition but different nucleotide sequence [ 7].
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
These same cases were also screened for the exon 21 L858R mutation by a PCR–restriction fragment length polymorphism assay, based on a new Sau96I restriction site created by the L858R mutation (2,573T→G).
The plasmid pMP8NEBΔLacZ was generated by ligating an 8 kb Xba1 fragment from pMP8 into the Xba1 site of pNEB193 (New England Biolabs) from which LacZ sequences had been removed as a NarI/EcoRI fragment [ 15 ] . This