Words similar to flanking

Example sentences for: flanking

How can you use “flanking” in a sentence? Here are some example sentences to help you improve your vocabulary:

At many of these genes, glucose repression is mediated, at least in part, by the glucose-dependent repressor Mig1, a zinc-finger protein that binds in vitro to DNA consensus sites consisting of a GC-rich core and flanking AT sequences [ 4, 5].
A cornucopia of bizarre creatures adorn the buildings flanking this pedestrian mall: giant monsters slither down the buildings, restaurants, cinemas, theaters, games centers, and steamy noodle bars.
The trans-silencers as well as their targets reside in single-copy, gene-rich regions that are only sparsely populated with repetitive or transposable elements, features that have been shown to mediate epigenetic activity in other cases [ 18 31 32 ] . Therefore trans-silencing of GFP-COP1 is probably not mediated by transgene flanking sequences [ 27 ] . In contrast, as with other genes cited above, trans-silencing ability is correlated with transgene locus structure, given that the C73 and C97 trans-silencers contain multiple T-DNAs while their targets, E82 and L91, are essentially dimeric and monomeric, respectively.
, MAG - R in pre-mRNA genes [ 13 ] ) need not be perfectly conserved in organisms but is rather a set of nucleotides that, with some statistical uncertainty, shows a non-random sequence pattern at sites flanking introns.
The genomic DNA fragment flanking the A54T polymorphism was amplified using two primers flanking exon 2 of the FABP2 gene: CTACCGAGTTTTCTTCCCACC and AATTAAACCATCCAATGAAATAGAGC.