Example sentences for: filaminarev

How can you use “filaminarev” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The probe for exon 15 of the filamin A gene was generated using primers AMINAFWD (GCCAATGTAGGCCTTCTTCAG) and FILAMINAREV (ATCCATGCCATCCACGTCAAG).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast