Example sentences for: fib

How can you use “fib” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.

  • Oh what a tangled web we weave when first we fib to act out against old boyfriends.

  • 3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.

  • Historians have argued for generations about whether Vespucci's 1497 trip was a fib.

  • Even Bill Clinton might have trouble executing this double-reverse flip-flop fib off the high board.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast