Words similar to fib
Example sentences for: fib
How can you use “fib” in a sentence? Here are some example sentences to help you improve your vocabulary:
3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.
Historians have argued for generations about whether Vespucci's 1497 trip was a fib.
3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.
Oh what a tangled web we weave when first we fib to act out against old boyfriends.
Even Bill Clinton might have trouble executing this double-reverse flip-flop fib off the high board.
Loading...