Words similar to fabp

Example sentences for: fabp

How can you use “fabp” in a sentence? Here are some example sentences to help you improve your vocabulary:

However, sib-pair analysis failed to detect any linkage of the FABP2 locus or the A54T polymorphism with diabetes related phenotypes in other ethnic groups [ 16, 17] as shown in Table 4A.
Because NIDDM is a genetic disorder [ 10] and results from an imbalance between insulin sensitivity and beta cell function, we hypothesized that the A54T polymorphism of the FABP2 gene plays a role in the pathogenesis of insulin resistance, which is one of the key determinants for the development of NIDDM [ 2].
Purified E-FABP has five fold higher affinity for 18:0, than for 18:1n9 and 20:4n6 (22:6n3 not studied) [ 69 ] . Herein, hepatic E-FABP expression (Fabp5 transcript) was down regulated by all three diets (-5.
The genomic DNA fragment flanking the A54T polymorphism was amplified using two primers flanking exon 2 of the FABP2 gene: CTACCGAGTTTTCTTCCCACC and AATTAAACCATCCAATGAAATAGAGC.
The FABP2 locus has been studied extensively.