Words similar to ex

Example sentences for: ex

How can you use “ex” in a sentence? Here are some example sentences to help you improve your vocabulary:

The probe for exon 4 of the CG1049 gene was generated using primers CG1049EX4FWD (TCTGTCCGATGAATTCATCGCC) and CG1049EX4REV (ATGATTCAGGTTCTCACGTCCG).
"Ex post fucto."
Like discarded lovers who keep driving past their ex's imagining the lurid scenes that are taking place inside, the tabs can't quite let go of Hillary, Bill, and Monica.
In response to melanoma targets mel526 and Malme-3M, which both express gp100 and MART-1 and are HLA-A*0201 positive, the two endogenous TAA-specific responses (samples from patients 132 and 461) also exhibited robust functional responses directly ex vivo (Table 1; 36.
House Majority Leader Richard Armey (R-Tex.)