Words similar to ex

Example sentences for: ex

How can you use “ex” in a sentence? Here are some example sentences to help you improve your vocabulary:

A specific exon 20 mutation (T790M) was also detected by length analysis of fluorescently labeled (FAM) PCR products on a capillary electrophoresis device (ABI 3100 Avant, Applied Biosystems, Foster City, California, United States), based on a new NlaIII restriction site created by the T790M mutation (2369 C→T), using the following primers: EGFR Ex20F, 5′-FAM- CTCCCTCCAGGAAGCCTACGTGAT-3′ and EGFR Ex20R 5′- TTTGCGATCTGCACACACCA-3′.
Finally, since the use of CEP cells would allow easy ex vivo gene transfer, combining growth factor-induced therapeutic angiogenesis with gene therapy delivered via CEP should also be a promising approach.
Cyclooxygenase activity was assessed ex vivo in hepatic tissue following a previously described method [ 30 ] . Briefly, mice were euthanized 3 hours following the final dose of vehicle or aspirin and a sample of liver tissue (~100 mg) was obtained.
Of course, after the fact, you could say the invitation was ex post fucto --lost in the mail.
The extracellular domain (amino acid residues Glu 24-His 159) of monkey proHB-EGF (GenBank accession number Q09118) [ 2 ] was amplified by PCR using primers MkHB-EGF ex (5') TCGGCACTGGTGGAATTCGAGAGCCTGGAG and MKHB-EGF ex (3') CACAGCCAGGATGGATCCATGGTCATAGGT.