Example sentences for: ends

How can you use “ends” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Conclusion: Netanyahu's entire goal is to preserve his own power, and he doesn't care if that ends the peace process.

  • Quiz categories include "People," "Science," "Odds and Ends," and "Things You Should Have Learned in School (Had You Been Paying Attention)."

  • Although the specific role of KHC in the differentiation process is unclear, this protein might be important for the maintenance of the plasticity and/or polarity of ECs, which may be a prerequisite for the formation of capillary ends.

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.

  • will be lessened, but not eliminated, because the targets are more likely to be near the real 3' ends of the mRNAs The truncation that results from amplifying samples means that the same protocol should be used for all samples in a given study.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast