Words similar to encore

Example sentences for: encore

How can you use “encore” in a sentence? Here are some example sentences to help you improve your vocabulary:

The PdL insert in this line was located in the large first intron of the encore gene [ 35], with the promoter oriented in the sense direction (Figure 3a).
The probe for exon 3 of the encore gene was generated using primers ENCFWD (AATGAAGCGGAGTTCCCAAAGC) and ENCREV (ATAAAGCCCGAGGTGTTGTTGC).
These transcripts were not detected in the absence of DOX in the adult males and this putative gene was named Red herring ( Rdh ). Northern analysis using a probe from encore exon 3 indicated that levels of the normal sized encore transcript were not detectably altered by DOX, as indicated by the arrowhead (Figure 3a).
encore is also required for normal early mitotic division of the germline cells [ 44].
Therefore it is also possible that the life span extension in this line is caused by an increase in the expression of encore , encore is a member of a novel family of proteins with multiple functions during Drosophila oogenesis [ 44].