Words similar to encore

Example sentences for: encore

How can you use “encore” in a sentence? Here are some example sentences to help you improve your vocabulary:

Therefore it is also possible that the life span extension in this line is caused by an increase in the expression of encore , encore is a member of a novel family of proteins with multiple functions during Drosophila oogenesis [ 44].
The PdL insert in this line was located in the large first intron of the encore gene [ 35], with the promoter oriented in the sense direction (Figure 3a).
The sizes of the products were: PdL(3)3E36 ( Red herring/encore ) 534 bp; PdL(2)4G14 ( VhaSFD ) 465 bp; PdL(3)2C33 ( Sugar baby ) 464 bp; PdL(3)8S64 ( filamin ) 362 bp; PdL(3)8S25 ( fwd ) 345 bp; PdL(3)8R128 ( Cct1 ) 298 bp.
The probe for exon 3 of the encore gene was generated using primers ENCFWD (AATGAAGCGGAGTTCCCAAAGC) and ENCREV (ATAAAGCCCGAGGTGTTGTTGC).
The largest average increase in life span caused by DOX (12%) was obtained for the PdL(2)3E36 insertion in the large first intron of the encore gene.