Words similar to encore

Example sentences for: encore

How can you use “encore” in a sentence? Here are some example sentences to help you improve your vocabulary:

And what, now, will they do for an encore?"
The probe for exon 3 of the encore gene was generated using primers ENCFWD (AATGAAGCGGAGTTCCCAAAGC) and ENCREV (ATAAAGCCCGAGGTGTTGTTGC).
Musical performances are many throughout this holiday season including an encore performance of Carols in the Courtyard as presented by the Christ Church Cathedral Choir.
The PdL insert in this line was located in the large first intron of the encore gene [ 35], with the promoter oriented in the sense direction (Figure 3a).
The largest average increase in life span caused by DOX (12%) was obtained for the PdL(2)3E36 insertion in the large first intron of the encore gene.