Words similar to encore

Example sentences for: encore

How can you use “encore” in a sentence? Here are some example sentences to help you improve your vocabulary:

And what, now, will they do for an encore?"
The probe for exon 3 of the encore gene was generated using primers ENCFWD (AATGAAGCGGAGTTCCCAAAGC) and ENCREV (ATAAAGCCCGAGGTGTTGTTGC).
The PdL insert in this line was located in the large first intron of the encore gene [ 35], with the promoter oriented in the sense direction (Figure 3a).
The largest average increase in life span caused by DOX (12%) was obtained for the PdL(2)3E36 insertion in the large first intron of the encore gene.
What went wrong is that Encore Encore sucked sucked."