Words similar to encore

Example sentences for: encore

How can you use “encore” in a sentence? Here are some example sentences to help you improve your vocabulary:

encore is also required for normal early mitotic division of the germline cells [ 44].
However, DOX appeared to induce expression of both larger and smaller RNAs containing encore coding-region sequences, resulting in a smear of hybridization in the upper part of the lane, as indicated by the asterisk.
Further experiments will be required to determine the mechanism of life-span extension in this line, and the elusive nature of the intronic gene suggested the name Red herring . The northern analyses also indicated induction of a small amount of a large transcript containing the encore coding region.
The probe for exon 3 of the encore gene was generated using primers ENCFWD (AATGAAGCGGAGTTCCCAAAGC) and ENCREV (ATAAAGCCCGAGGTGTTGTTGC).
These transcripts were not detected in the absence of DOX in the adult males and this putative gene was named Red herring ( Rdh ). Northern analysis using a probe from encore exon 3 indicated that levels of the normal sized encore transcript were not detectably altered by DOX, as indicated by the arrowhead (Figure 3a).